Review



stable hif1a construct  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc stable hif1a construct
    Stable Hif1a Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stable+hif1a+construct/HA-HIF1alpha+P402A%2FP564A-pcDNA3+(Plasmid+%2318955)/pmc09678334-633-1-7
    Average 94 stars, based on 66 article reviews
    stable hif1a construct - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Construct:

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC. .. For generation of single gene knockout cell lines, lentiviral vector expressing the corresponding sgRNA was transfected into HEK293T cells with lentiviral packaging vectors VSV-G and Delta-VPR using XtremeGene transfection reagent (Roche).

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) 35 and amplified by PCR. ..

    Amplification:

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC. .. For generation of single gene knockout cell lines, lentiviral vector expressing the corresponding sgRNA was transfected into HEK293T cells with lentiviral packaging vectors VSV-G and Delta-VPR using XtremeGene transfection reagent (Roche).

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) 35 and amplified by PCR. ..

    Polymerase Chain Reaction:

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC. .. For generation of single gene knockout cell lines, lentiviral vector expressing the corresponding sgRNA was transfected into HEK293T cells with lentiviral packaging vectors VSV-G and Delta-VPR using XtremeGene transfection reagent (Roche).

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) 35 and amplified by PCR. ..

    Cloning:

    Article Title: Adaptive stimulation of macropinocytosis overcomes aspartate limitation in cancer cells under hypoxia
    Article Snippet: .. Constitutively stable HIF1A construct was obtained from Addgene (HA-HIF1alpha P402A/P564A-pcDNA3) , and amplified by PCR using the following primers prior to its cloning into PMXS-IRES-Blast: HIF1A_cDNA_F, GCCGGATCTAGCTAGTTAATTAAGCCACCATGGCCTACCCCTACGACGTGCCCGACT; HIF1A_cDNA_R, GGGCGGAATTTACGTAGCTCAGTTAACTTGATCCAAAGCTCTGAGTAATTC. .. For generation of single gene knockout cell lines, lentiviral vector expressing the corresponding sgRNA was transfected into HEK293T cells with lentiviral packaging vectors VSV-G and Delta-VPR using XtremeGene transfection reagent (Roche).



    Similar Products

    stable hif1a construct  (Addgene inc)
    94
    Addgene inc stable hif1a construct
    Stable Hif1a Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stable+hif1a+construct/HA-HIF1alpha+P402A%2FP564A-pcDNA3+(Plasmid+%2318955)/pmc09678334-633-1-7
    Average 94 stars, based on 1 article reviews
    stable hif1a construct - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results